Transcript: Mouse NM_009059.2

Mus musculus ral guanine nucleotide dissociation stimulator-like 2 (Rgl2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rgl2 (19732)
Length:
2967
CDS:
193..2529

Additional Resources:

NCBI RefSeq record:
NM_009059.2
NBCI Gene record:
Rgl2 (19732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110137 CCTCCGACCTAACTCTGATAT pLKO.1 1635 CDS 100% 13.200 18.480 N Rgl2 n/a
2 TRCN0000110136 GTGTTATTAGTCGTGTCCTTA pLKO.1 2228 CDS 100% 4.950 6.930 N Rgl2 n/a
3 TRCN0000110139 GATGCGGAACTGTTTCTTAAT pLKO.1 955 CDS 100% 13.200 9.240 N Rgl2 n/a
4 TRCN0000455106 GGAGAATGGCTACATCAATTT pLKO_005 1542 CDS 100% 13.200 9.240 N Rgl2 n/a
5 TRCN0000110135 GCCACAATATTAGAGCAGAAA pLKO.1 2591 3UTR 100% 4.950 3.465 N Rgl2 n/a
6 TRCN0000110138 CCTAACTCTGATATCCAGCAA pLKO.1 1642 CDS 100% 2.640 1.848 N Rgl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009059.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.