Transcript: Mouse NM_009131.3

Mus musculus C-type lectin domain family 11, member a (Clec11a), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Clec11a (20256)
Length:
1970
CDS:
195..1181

Additional Resources:

NCBI RefSeq record:
NM_009131.3
NBCI Gene record:
Clec11a (20256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089427 GATGCGCTAAGCCGGTACTTA pLKO.1 870 CDS 100% 5.625 7.875 N Clec11a n/a
2 TRCN0000089424 GTGGGAAATGAGGATAATCTT pLKO.1 375 CDS 100% 5.625 3.938 N Clec11a n/a
3 TRCN0000089426 CCTCTACTTCGTCTGCGAGTT pLKO.1 1151 CDS 100% 4.050 2.835 N Clec11a n/a
4 TRCN0000089425 AGCACCTTCTTCTAGTCCCAA pLKO.1 473 CDS 100% 2.640 1.848 N Clec11a n/a
5 TRCN0000089423 TCAGAGATTAAGCGTGACCAT pLKO.1 1264 3UTR 100% 2.640 1.848 N Clec11a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.