Transcript: Mouse NM_009149.2

Mus musculus golgi apparatus protein 1 (Glg1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Glg1 (20340)
Length:
3880
CDS:
7..3534

Additional Resources:

NCBI RefSeq record:
NM_009149.2
NBCI Gene record:
Glg1 (20340)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313609 AGTTAGAGTCCGAGGATATAC pLKO_005 2033 CDS 100% 13.200 18.480 N Glg1 n/a
2 TRCN0000313607 GCTCATTGCCCAGGATTATAA pLKO_005 1074 CDS 100% 15.000 12.000 N Glg1 n/a
3 TRCN0000313606 TCAACTATTTCCGAGATTAAA pLKO_005 538 CDS 100% 15.000 10.500 N Glg1 n/a
4 TRCN0000424164 CCAAGATGACGGCCATCATTT pLKO_005 656 CDS 100% 13.200 9.240 N GLG1 n/a
5 TRCN0000126379 ACAGCCGTCCTGTATAGTGTA pLKO.1 3581 3UTR 100% 4.950 3.465 N Glg1 n/a
6 TRCN0000317107 ACAGCCGTCCTGTATAGTGTA pLKO_005 3581 3UTR 100% 4.950 3.465 N Glg1 n/a
7 TRCN0000126383 CCAGGATTATAAAGTCAGTTA pLKO.1 1083 CDS 100% 4.950 3.465 N Glg1 n/a
8 TRCN0000126381 CGAGGCAACATCACTGAGTAT pLKO.1 616 CDS 100% 4.950 3.465 N Glg1 n/a
9 TRCN0000126380 CGGCTCTTAGAGCTACAGTAT pLKO.1 1627 CDS 100% 4.950 3.465 N Glg1 n/a
10 TRCN0000126382 CCAAGTTATCTCATGCCTCAA pLKO.1 2889 CDS 100% 4.050 2.835 N Glg1 n/a
11 TRCN0000148720 CCTGTAAAGCTGACATTCCTA pLKO.1 2816 CDS 100% 3.000 2.100 N GLG1 n/a
12 TRCN0000313608 AGAGTGTATAAATGCCTATTT pLKO_005 991 CDS 100% 13.200 7.920 N Glg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.