Transcript: Mouse NM_009152.4

Mus musculus sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A (Sema3a), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Sema3a (20346)
Length:
6850
CDS:
650..2968

Additional Resources:

NCBI RefSeq record:
NM_009152.4
NBCI Gene record:
Sema3a (20346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009152.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067329 GCAGGATGTATTCCTAATGAA pLKO.1 1573 CDS 100% 5.625 7.875 N Sema3a n/a
2 TRCN0000067332 CCCAGTGTTTCCTATAAATAA pLKO.1 1882 CDS 100% 15.000 10.500 N Sema3a n/a
3 TRCN0000067330 CCTGAAAGAATGTGCCAATTT pLKO.1 979 CDS 100% 13.200 9.240 N Sema3a n/a
4 TRCN0000067328 GCCTTGGTATATTGGCAATTT pLKO.1 2462 CDS 100% 13.200 9.240 N Sema3a n/a
5 TRCN0000067331 CGAGACTTCATGCAGCTCATT pLKO.1 2762 CDS 100% 4.950 3.465 N Sema3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009152.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.