Transcript: Mouse NM_009188.4

Mus musculus transcriptional regulator, SIN3B (yeast) (Sin3b), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sin3b (20467)
Length:
4135
CDS:
41..3337

Additional Resources:

NCBI RefSeq record:
NM_009188.4
NBCI Gene record:
Sin3b (20467)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009188.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294922 TGACGTTTGCACATGTATTTA pLKO_005 3538 3UTR 100% 15.000 21.000 N Sin3b n/a
2 TRCN0000294921 GTGCCATACACCGCATCTATG pLKO_005 1542 CDS 100% 10.800 15.120 N Sin3b n/a
3 TRCN0000294923 TATGCGTCTTGTAAGCGAATA pLKO_005 1184 CDS 100% 10.800 15.120 N Sin3b n/a
4 TRCN0000039366 CCGCACCTTATCTTCGTGTAT pLKO.1 1865 CDS 100% 4.950 6.930 N Sin3b n/a
5 TRCN0000039365 GCCTGCTCAATGAGATCGAAA pLKO.1 1785 CDS 100% 4.950 6.930 N Sin3b n/a
6 TRCN0000294959 AGATGGTGTTCATCGTCAATT pLKO_005 3039 CDS 100% 13.200 9.240 N Sin3b n/a
7 TRCN0000039368 CCAGGAGGTATATGAGAACTT pLKO.1 973 CDS 100% 4.950 3.465 N Sin3b n/a
8 TRCN0000039367 CCGTATAGACATTCCCAAGAA pLKO.1 343 CDS 100% 4.950 3.465 N Sin3b n/a
9 TRCN0000287547 CCGTATAGACATTCCCAAGAA pLKO_005 343 CDS 100% 4.950 3.465 N Sin3b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009188.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.