Transcript: Mouse NM_009194.3

Mus musculus solute carrier family 12, member 2 (Slc12a2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Slc12a2 (20496)
Length:
6520
CDS:
130..3750

Additional Resources:

NCBI RefSeq record:
NM_009194.3
NBCI Gene record:
Slc12a2 (20496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009194.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055391 CCCTTATTGGAGCAATTCTTT pLKO.1 2258 CDS 100% 5.625 7.875 N Slc12a2 n/a
2 TRCN0000055389 CCTGCTTTACTTCATCTTGTT pLKO.1 2515 CDS 100% 4.950 6.930 N Slc12a2 n/a
3 TRCN0000055388 GCCGAGAGTAAAGGAGTTGTA pLKO.1 940 CDS 100% 4.950 6.930 N Slc12a2 n/a
4 TRCN0000055390 CCGGATAGACTTCTCTGATAT pLKO.1 3348 CDS 100% 13.200 9.240 N Slc12a2 n/a
5 TRCN0000055392 CGTCCTTACCTTCTACTCATA pLKO.1 3729 CDS 100% 4.950 2.970 N Slc12a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009194.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.