Transcript: Mouse NM_009202.5

Mus musculus solute carrier family 22 (organic cation transporter), member 1 (Slc22a1), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Slc22a1 (20517)
Length:
1994
CDS:
180..1850

Additional Resources:

NCBI RefSeq record:
NM_009202.5
NBCI Gene record:
Slc22a1 (20517)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009202.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000070157 CTACCCAATAGCGGCATCAAA pLKO.1 1391 CDS 100% 5.625 7.875 N Slc22a1 n/a
2 TRCN0000070154 CCCAGACTATACATCCATGTT pLKO.1 770 CDS 100% 4.950 6.930 N Slc22a1 n/a
3 TRCN0000070156 CACACCCTCATCCTGATGTAT pLKO.1 1218 CDS 100% 5.625 3.938 N Slc22a1 n/a
4 TRCN0000070155 CGATTTACCTTCAGGTCCAAA pLKO.1 1807 CDS 100% 4.950 3.465 N Slc22a1 n/a
5 TRCN0000070153 CGGTAAGGATAATGGAGCAAA pLKO.1 1075 CDS 100% 4.950 3.465 N Slc22a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009202.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.