Transcript: Mouse NM_009203.3

Mus musculus solute carrier family 22 (organic anion/cation transporter), member 12 (Slc22a12), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc22a12 (20521)
Length:
2255
CDS:
319..1980

Additional Resources:

NCBI RefSeq record:
NM_009203.3
NBCI Gene record:
Slc22a12 (20521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079302 CCGATGTTCTTCTGGCCGTCT pLKO.1 524 CDS 100% 0.720 0.576 N Slc22a12 n/a
2 TRCN0000079300 GCCTGACACCATCCAAGACAT pLKO.1 1887 CDS 100% 4.950 3.465 N Slc22a12 n/a
3 TRCN0000079298 CCACAATAAGAGGAGGAGGAA pLKO.1 2002 3UTR 100% 2.640 1.848 N Slc22a12 n/a
4 TRCN0000079301 CCACCGAACCATCATCTCCAT pLKO.1 1359 CDS 100% 2.640 1.848 N Slc22a12 n/a
5 TRCN0000079299 GCAAGCCCTAGGAAGCAATAT pLKO.1 1431 CDS 100% 13.200 7.920 N Slc22a12 n/a
6 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 2018 3UTR 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009203.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.