Transcript: Mouse NM_009211.2

Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1 (Smarcc1), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Smarcc1 (20588)
Length:
5684
CDS:
94..3408

Additional Resources:

NCBI RefSeq record:
NM_009211.2
NBCI Gene record:
Smarcc1 (20588)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071389 GCCGCTCAACAGATGTTAAAT pLKO.1 1822 CDS 100% 15.000 21.000 N Smarcc1 n/a
2 TRCN0000071388 CCTGAAATATACTTGGCATAT pLKO.1 1540 CDS 100% 10.800 7.560 N Smarcc1 n/a
3 TRCN0000071391 CAGTTGAAATATGCTGAACTA pLKO.1 2926 CDS 100% 4.950 3.465 N Smarcc1 n/a
4 TRCN0000071390 GCCAACTCTAGGAAGAGGAAA pLKO.1 1048 CDS 100% 4.950 2.970 N Smarcc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.