Transcript: Mouse NM_009214.4

Mus musculus spermine synthase (Sms), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Sms (20603)
Length:
3721
CDS:
335..1435

Additional Resources:

NCBI RefSeq record:
NM_009214.4
NBCI Gene record:
Sms (20603)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009214.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076268 CCCACTGTACTGTTATTCTTA pLKO.1 2737 3UTR 100% 5.625 3.938 N Sms n/a
2 TRCN0000076270 CTGAAGATGTACGCCAAAGAA pLKO.1 1112 CDS 100% 5.625 2.813 Y Sms n/a
3 TRCN0000076271 CGCCTGGTTGAGTATGACATA pLKO.1 722 CDS 100% 4.950 2.475 Y Sms n/a
4 TRCN0000076269 GTCTGTATTGTCCTGTGGAAT pLKO.1 1335 CDS 100% 4.950 2.475 Y Sms n/a
5 TRCN0000076272 CCCTATCTCTACATCTCCAGA pLKO.1 1174 CDS 100% 2.640 1.320 Y Sms n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009214.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.