Transcript: Mouse NM_009251.1

Mus musculus serine (or cysteine) peptidase inhibitor, clade A, member 3G (Serpina3g), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Serpina3g (20715)
Length:
2030
CDS:
90..1412

Additional Resources:

NCBI RefSeq record:
NM_009251.1
NBCI Gene record:
Serpina3g (20715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087144 CGGCTGGAATCTAAGCGTTTA pLKO.1 1356 CDS 100% 10.800 15.120 N Serpina3g n/a
2 TRCN0000087146 GAGCTGAAATACACAGGAAAT pLKO.1 846 CDS 100% 10.800 6.480 N Serpina3g n/a
3 TRCN0000087143 CCAACCCATAAGGACTAAGAA pLKO.1 1668 3UTR 100% 5.625 3.375 N Serpina3g n/a
4 TRCN0000087145 CGAGTTCTACTTGGATGAGAA pLKO.1 740 CDS 100% 4.950 2.970 N Serpina3g n/a
5 TRCN0000087147 GATGATTATCTCTGACACAAA pLKO.1 1250 CDS 100% 4.950 2.475 Y Serpina3g n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.