Transcript: Mouse NM_009270.3

Mus musculus squalene epoxidase (Sqle), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sqle (20775)
Length:
2748
CDS:
754..2472

Additional Resources:

NCBI RefSeq record:
NM_009270.3
NBCI Gene record:
Sqle (20775)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076686 GAGCCCAATGTAAAGTTTATA pLKO.1 1465 CDS 100% 15.000 10.500 N Sqle n/a
2 TRCN0000327508 GAGCCCAATGTAAAGTTTATA pLKO_005 1465 CDS 100% 15.000 10.500 N Sqle n/a
3 TRCN0000076683 GCTTGTGTATAAGCATGTAAA pLKO.1 2566 3UTR 100% 13.200 9.240 N Sqle n/a
4 TRCN0000327509 GCTTGTGTATAAGCATGTAAA pLKO_005 2566 3UTR 100% 13.200 9.240 N Sqle n/a
5 TRCN0000076684 CCAGTTCTCATCTACCAGATT pLKO.1 1738 CDS 100% 4.950 3.465 N Sqle n/a
6 TRCN0000327505 CCAGTTCTCATCTACCAGATT pLKO_005 1738 CDS 100% 4.950 3.465 N Sqle n/a
7 TRCN0000076687 CCATCATATACATGGCTACAT pLKO.1 1314 CDS 100% 4.950 3.465 N Sqle n/a
8 TRCN0000327590 CCATCATATACATGGCTACAT pLKO_005 1314 CDS 100% 4.950 3.465 N Sqle n/a
9 TRCN0000076685 GCCACGTATTTCTGCTTCAAA pLKO.1 2335 CDS 100% 5.625 3.375 N Sqle n/a
10 TRCN0000327591 GCCACGTATTTCTGCTTCAAA pLKO_005 2335 CDS 100% 5.625 3.375 N Sqle n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009270.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.