Transcript: Mouse NM_009278.4

Mus musculus Sjogren syndrome antigen B (Ssb), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ssb (20823)
Length:
2088
CDS:
205..1452

Additional Resources:

NCBI RefSeq record:
NM_009278.4
NBCI Gene record:
Ssb (20823)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071287 GAACAGATCAAATTGGATGAA pLKO.1 316 CDS 100% 4.950 6.930 N Ssb n/a
2 TRCN0000302252 GAACAGATCAAATTGGATGAA pLKO_005 316 CDS 100% 4.950 6.930 N Ssb n/a
3 TRCN0000071284 CGGCTGACAACAGACTTTAAT pLKO.1 382 CDS 100% 15.000 10.500 N Ssb n/a
4 TRCN0000302253 CGGCTGACAACAGACTTTAAT pLKO_005 382 CDS 100% 15.000 10.500 N Ssb n/a
5 TRCN0000071283 CCCGCATCAAAGCATAAGAAA pLKO.1 1405 CDS 100% 5.625 3.938 N Ssb n/a
6 TRCN0000302250 CCCGCATCAAAGCATAAGAAA pLKO_005 1405 CDS 100% 5.625 3.938 N Ssb n/a
7 TRCN0000071286 GAGAAGATTTACACTTCCTTT pLKO.1 938 CDS 100% 4.950 3.465 N Ssb n/a
8 TRCN0000302176 GAGAAGATTTACACTTCCTTT pLKO_005 938 CDS 100% 4.950 3.465 N Ssb n/a
9 TRCN0000071285 GCAGAGCAAAGTGGAAGCTAA pLKO.1 795 CDS 100% 4.950 3.465 N Ssb n/a
10 TRCN0000302178 GCAGAGCAAAGTGGAAGCTAA pLKO_005 795 CDS 100% 4.950 3.465 N Ssb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009278.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.