Transcript: Mouse NM_009292.1

Mus musculus stimulated by retinoic acid gene 8 (Stra8), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Stra8 (20899)
Length:
1455
CDS:
102..1283

Additional Resources:

NCBI RefSeq record:
NM_009292.1
NBCI Gene record:
Stra8 (20899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216621 GAATAGGACAAAGATTCATAT pLKO.1 305 CDS 100% 13.200 10.560 N Stra8 n/a
2 TRCN0000182159 CCGGACCTCATGGAATTTGAA pLKO.1 720 CDS 100% 5.625 4.500 N Stra8 n/a
3 TRCN0000198820 CGAGAATGACAGTGTATTCCT pLKO.1 443 CDS 100% 3.000 2.400 N Stra8 n/a
4 TRCN0000182007 CGGAGAAGGAGGAGATTAAAT pLKO.1 1295 3UTR 100% 15.000 10.500 N Stra8 n/a
5 TRCN0000178313 GCTGTGTTAACACTCCATTAA pLKO.1 1189 CDS 100% 13.200 9.240 N Stra8 n/a
6 TRCN0000215386 CATGAAGTGACACTTCCTATT pLKO.1 804 CDS 100% 10.800 7.560 N Stra8 n/a
7 TRCN0000178496 CAGCTCTACATACAGATCATT pLKO.1 1149 CDS 100% 5.625 3.938 N Stra8 n/a
8 TRCN0000181621 GAAGCTCAAAGCATCCTTCAA pLKO.1 359 CDS 100% 4.950 3.465 N Stra8 n/a
9 TRCN0000217050 CTAACATCAGCGCTATGTTTG pLKO.1 1093 CDS 100% 1.080 0.756 N Stra8 n/a
10 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 558 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.