Transcript: Mouse NM_009298.4

Mus musculus surfeit gene 6 (Surf6), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Surf6 (20935)
Length:
2996
CDS:
101..1168

Additional Resources:

NCBI RefSeq record:
NM_009298.4
NBCI Gene record:
Surf6 (20935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009298.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193431 GCTATGGATCACAAGACTAAA pLKO.1 284 CDS 100% 13.200 18.480 N Surf6 n/a
2 TRCN0000174618 GCGCTTATTAAAGATGTGGTA pLKO.1 1867 3UTR 100% 2.640 3.696 N Surf6 n/a
3 TRCN0000276809 AGGAATCAGGGCTGATCTTTA pLKO_005 663 CDS 100% 13.200 9.240 N Surf6 n/a
4 TRCN0000194220 GCACTGGAGTAAGAGTCATTA pLKO.1 2512 3UTR 100% 13.200 9.240 N Surf6 n/a
5 TRCN0000276811 TGTTTCATCAGCATCTTTAAG pLKO_005 1345 3UTR 100% 13.200 9.240 N Surf6 n/a
6 TRCN0000175524 CAAGATGAAGTGGACCAACTT pLKO.1 880 CDS 100% 4.950 3.465 N Surf6 n/a
7 TRCN0000285672 CAAGATGAAGTGGACCAACTT pLKO_005 880 CDS 100% 4.950 3.465 N Surf6 n/a
8 TRCN0000175426 CAGGAACAGAAAGCTATGGAT pLKO.1 272 CDS 100% 3.000 2.100 N Surf6 n/a
9 TRCN0000276810 CAGGAACAGAAAGCTATGGAT pLKO_005 272 CDS 100% 3.000 2.100 N Surf6 n/a
10 TRCN0000173751 CAAGAAGGAGAAGAGGCAGAA pLKO.1 730 CDS 100% 4.050 2.430 N Surf6 n/a
11 TRCN0000285675 CAAGAAGGAGAAGAGGCAGAA pLKO_005 730 CDS 100% 4.050 2.430 N Surf6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009298.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.