Transcript: Mouse NM_009328.2

Mus musculus transcription factor 15 (Tcf15), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Tcf15 (21407)
Length:
949
CDS:
18..605

Additional Resources:

NCBI RefSeq record:
NM_009328.2
NBCI Gene record:
Tcf15 (21407)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085022 CGACGACGGGCAGCCGTGTTT pLKO.1 413 CDS 100% 0.000 0.000 N Tcf15 n/a
2 TRCN0000015257 CGACGCGTCGGACCAGTCGTT pLKO.1 110 CDS 100% 0.000 0.000 N TCF15 n/a
3 TRCN0000085021 CGCGCTCCATCTGCACCTTCT pLKO.1 487 CDS 100% 0.000 0.000 N Tcf15 n/a
4 TRCN0000015256 GCACGTGCTGTACCCGGACGT pLKO.1 50 CDS 100% 0.000 0.000 N TCF15 n/a
5 TRCN0000419484 ATGAACCTGGATCCCTGGTTT pLKO_005 602 CDS 100% 4.950 3.465 N Tcf15 n/a
6 TRCN0000085019 CGTGGACCGAAAGCTGTCTAA pLKO.1 320 CDS 100% 4.950 3.465 N Tcf15 n/a
7 TRCN0000415296 CACAAGGACCCATCTAGCCAT pLKO_005 765 3UTR 100% 2.640 1.848 N Tcf15 n/a
8 TRCN0000085020 GCAGAGCGTGAACACGGCCTT pLKO.1 266 CDS 100% 0.000 0.000 N Tcf15 n/a
9 TRCN0000085018 AGCTGGACAGAGGAGAAGATT pLKO.1 667 3UTR 100% 5.625 2.813 Y Tcf15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009328.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.