Transcript: Mouse NM_009349.3

Mus musculus indolethylamine N-methyltransferase (Inmt), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Inmt (21743)
Length:
1023
CDS:
8..802

Additional Resources:

NCBI RefSeq record:
NM_009349.3
NBCI Gene record:
Inmt (21743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009349.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097463 CTGCCCTGATATAGATACCTA pLKO.1 517 CDS 100% 3.000 4.200 N Inmt n/a
2 TRCN0000097462 AGAGCAGGAAATCGTAAAGTT pLKO.1 109 CDS 100% 5.625 4.500 N Inmt n/a
3 TRCN0000097460 GAGCAGGAAATCGTAAAGTTT pLKO.1 110 CDS 100% 5.625 4.500 N Inmt n/a
4 TRCN0000097461 CCTCCATAGTGCAACATGCAT pLKO.1 333 CDS 100% 3.000 2.100 N Inmt n/a
5 TRCN0000097459 CCCTGGGAAAGTTATAGCAAT pLKO.1 826 3UTR 100% 4.950 2.970 N Inmt n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009349.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.