Transcript: Mouse NM_009359.4

Mus musculus testis expressed gene 9 (Tex9), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tex9 (21778)
Length:
4317
CDS:
8..1171

Additional Resources:

NCBI RefSeq record:
NM_009359.4
NBCI Gene record:
Tex9 (21778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009359.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240675 ACAAGAGTACAAGCGTTTAAA pLKO_005 103 CDS 100% 15.000 10.500 N Tex9 n/a
2 TRCN0000240677 GACAAGCTGAGGAAGTAATAA pLKO_005 159 CDS 100% 15.000 10.500 N Tex9 n/a
3 TRCN0000240676 TCATCAGTAGAACGGGAATTA pLKO_005 809 CDS 100% 13.200 9.240 N Tex9 n/a
4 TRCN0000240673 ACAGAGGCTCAGATCCGATTT pLKO_005 563 CDS 100% 10.800 7.560 N Tex9 n/a
5 TRCN0000240674 TGTGGCCATCCCAGACGATTT pLKO_005 427 CDS 100% 10.800 7.560 N Tex9 n/a
6 TRCN0000192029 CCCAGCAATCCCAAATAGAAA pLKO.1 729 CDS 100% 5.625 3.938 N Tex9 n/a
7 TRCN0000190938 CCCAGACGATTTCTCAGACTT pLKO.1 436 CDS 100% 4.950 3.465 N Tex9 n/a
8 TRCN0000191506 GCAGTTGAAATTGATTGACAT pLKO.1 1057 CDS 100% 4.950 3.465 N Tex9 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2760 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009359.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.