Transcript: Mouse NM_009410.2

Mus musculus topoisomerase (DNA) III alpha (Top3a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Top3a (21975)
Length:
3740
CDS:
265..3276

Additional Resources:

NCBI RefSeq record:
NM_009410.2
NBCI Gene record:
Top3a (21975)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071001 CGAGTTCATTGTTCGCCATTT pLKO.1 1566 CDS 100% 10.800 15.120 N Top3a n/a
2 TRCN0000071002 CCTGTCTCAACCTCTGGTTAA pLKO.1 2607 CDS 100% 10.800 8.640 N Top3a n/a
3 TRCN0000070999 GCCAGAATGTTACTATGATAA pLKO.1 500 CDS 100% 13.200 9.240 N Top3a n/a
4 TRCN0000071000 GCTTTGAGATTATCCACGTAT pLKO.1 734 CDS 100% 4.950 3.465 N Top3a n/a
5 TRCN0000070998 GCAGTCAGCATGTAAGCAGAA pLKO.1 3509 3UTR 100% 4.050 2.835 N Top3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009410.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.