Transcript: Mouse NM_009437.4

Mus musculus thiosulfate sulfurtransferase, mitochondrial (Tst), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Tst (22117)
Length:
1096
CDS:
27..920

Additional Resources:

NCBI RefSeq record:
NM_009437.4
NBCI Gene record:
Tst (22117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009437.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111032 CCTAGAGAATCTCCAGTCTAA pLKO.1 530 CDS 100% 4.950 6.930 N Tst n/a
2 TRCN0000325243 CCTAGAGAATCTCCAGTCTAA pLKO_005 530 CDS 100% 4.950 6.930 N Tst n/a
3 TRCN0000305971 ACACAACCGGAGCCGGATATA pLKO_005 597 CDS 100% 13.200 9.240 N Tst n/a
4 TRCN0000111031 CCTTCTTTGATATAGAGGAAT pLKO.1 196 CDS 100% 4.950 3.465 N Tst n/a
5 TRCN0000111034 CCGCACAGTGTCAGTGCTCAA pLKO.1 389 CDS 100% 1.350 0.945 N Tst n/a
6 TRCN0000325319 CCGCACAGTGTCAGTGCTCAA pLKO_005 389 CDS 100% 1.350 0.945 N Tst n/a
7 TRCN0000111030 GCCCACCCAATCCAGCCAGTT pLKO.1 942 3UTR 100% 0.000 0.000 N Tst n/a
8 TRCN0000325320 GCCCACCCAATCCAGCCAGTT pLKO_005 942 3UTR 100% 0.000 0.000 N Tst n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009437.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.