Transcript: Mouse NM_009445.2

Mus musculus Ttk protein kinase (Ttk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ttk (22137)
Length:
2904
CDS:
90..2582

Additional Resources:

NCBI RefSeq record:
NM_009445.2
NBCI Gene record:
Ttk (22137)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366000 AGATTGAATTTCCCGAGATTT pLKO_005 2266 CDS 100% 13.200 18.480 N Ttk n/a
2 TRCN0000374378 AGATCTTCGAGACGTGTTAAA pLKO_005 2294 CDS 100% 13.200 10.560 N Ttk n/a
3 TRCN0000028843 CCACCAATATCAGTTCCTAAA pLKO.1 1317 CDS 100% 10.800 8.640 N Ttk n/a
4 TRCN0000028771 GCCACTGATGAAATGAAATAT pLKO.1 2421 CDS 100% 15.000 10.500 N Ttk n/a
5 TRCN0000365999 CCTATGAACTGAGAGGTTTAA pLKO_005 1036 CDS 100% 13.200 9.240 N Ttk n/a
6 TRCN0000366071 CTCTAAACTGCACGCCATAAT pLKO_005 2231 CDS 100% 13.200 9.240 N Ttk n/a
7 TRCN0000374379 CCAAGAACACTAGATTGTTTC pLKO_005 2601 3UTR 100% 10.800 7.560 N Ttk n/a
8 TRCN0000028789 CCAGATAAATACGGCCAGAAT pLKO.1 375 CDS 100% 4.950 3.465 N Ttk n/a
9 TRCN0000006357 CCAGTTGTAAAGAATGACTTT pLKO.1 1413 CDS 100% 4.950 3.465 N TTK n/a
10 TRCN0000028824 GCTTGCAGATTTCAGGTTCTT pLKO.1 1522 CDS 100% 4.950 3.465 N Ttk n/a
11 TRCN0000028833 GCACAGTTTGAACTGTCTCAA pLKO.1 525 CDS 100% 0.495 0.347 N Ttk n/a
12 TRCN0000374380 GGTTGGCACAGTTAACTATAT pLKO_005 2057 CDS 100% 13.200 7.920 N Ttk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009445.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.