Transcript: Mouse NM_009461.2

Mus musculus ubiquitin protein ligase E3 component n-recognin 1 (Ubr1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ubr1 (22222)
Length:
7765
CDS:
114..5387

Additional Resources:

NCBI RefSeq record:
NM_009461.2
NBCI Gene record:
Ubr1 (22222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365849 TGCCAGAATATCGGGTTATAA pLKO_005 3842 CDS 100% 15.000 21.000 N Ubr1 n/a
2 TRCN0000040924 CGCAGTTATATGTGACCTAAA pLKO.1 1532 CDS 100% 10.800 15.120 N Ubr1 n/a
3 TRCN0000003425 GCTGGTCTTCATGTACGTTTA pLKO.1 1959 CDS 100% 10.800 15.120 N UBR1 n/a
4 TRCN0000040926 CCGGATATTTGCTTAGAGAAA pLKO.1 360 CDS 100% 4.950 6.930 N Ubr1 n/a
5 TRCN0000040927 CCAGGATTTGATTAAACAGTA pLKO.1 2300 CDS 100% 4.950 3.960 N Ubr1 n/a
6 TRCN0000365924 TTACCAGAGAGGAGGTTATAA pLKO_005 2398 CDS 100% 15.000 10.500 N Ubr1 n/a
7 TRCN0000376750 TTGGAGAGGATCCGGATATTT pLKO_005 349 CDS 100% 15.000 10.500 N Ubr1 n/a
8 TRCN0000365923 CATAACTGTCCTAGTTCATTT pLKO_005 5680 3UTR 100% 13.200 9.240 N Ubr1 n/a
9 TRCN0000374110 CTGGTCTTCATGTACGTTTAA pLKO_005 1960 CDS 100% 13.200 9.240 N Ubr1 n/a
10 TRCN0000376677 GAATATTCCCTTCGGTGATAA pLKO_005 688 CDS 100% 13.200 9.240 N Ubr1 n/a
11 TRCN0000374109 GATCACCTGTGATGGTCTAAA pLKO_005 5834 3UTR 100% 13.200 9.240 N Ubr1 n/a
12 TRCN0000374033 ACACGACTGCCATCGACAAAG pLKO_005 889 CDS 100% 10.800 7.560 N Ubr1 n/a
13 TRCN0000040923 GCACCTTTGTATTTGGTGTTT pLKO.1 5772 3UTR 100% 4.950 3.465 N Ubr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009461.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.