Transcript: Mouse NM_009467.3

Mus musculus UDP glucuronosyltransferase 2 family, polypeptide B5 (Ugt2b5), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ugt2b5 (22238)
Length:
1901
CDS:
35..1627

Additional Resources:

NCBI RefSeq record:
NM_009467.3
NBCI Gene record:
Ugt2b5 (22238)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093756 ACCACTATAGTCCTTAGTGTA pLKO.1 1544 CDS 100% 0.495 0.693 N Ugt2b5 n/a
2 TRCN0000093755 CCACTATAGTCCTTAGTGTAA pLKO.1 1545 CDS 100% 0.495 0.693 N Ugt2b5 n/a
3 TRCN0000093754 GAACAAACTTTCAGCCTCATT pLKO.1 1651 3UTR 100% 4.950 3.465 N Ugt2b5 n/a
4 TRCN0000093757 CCCTCTTATGTACCTGTAATT pLKO.1 608 CDS 100% 13.200 6.600 Y Ugt2b5 n/a
5 TRCN0000093932 CCAGCAACTTTAGGACACAAT pLKO.1 1067 CDS 100% 4.950 2.475 Y Ugt2b38 n/a
6 TRCN0000093758 CCCAGCAACTTTAGGACACAA pLKO.1 1066 CDS 100% 4.950 2.475 Y Ugt2b5 n/a
7 TRCN0000093933 CCTCCCTCTTATGTACCTGTA pLKO.1 605 CDS 100% 4.050 2.025 Y Ugt2b38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009467.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.