Transcript: Mouse NM_009469.3

Mus musculus unc-51 like kinase 1 (Ulk1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ulk1 (22241)
Length:
5215
CDS:
358..3513

Additional Resources:

NCBI RefSeq record:
NM_009469.3
NBCI Gene record:
Ulk1 (22241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009469.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361568 CAGGTGGTACGCAGACTAAAT pLKO_005 3160 CDS 100% 13.200 18.480 N Ulk1 n/a
2 TRCN0000028822 CGCATGGACTTTGATGAATTT pLKO.1 1153 CDS 100% 13.200 9.240 N Ulk1 n/a
3 TRCN0000319763 CGCATGGACTTTGATGAATTT pLKO_005 1153 CDS 100% 13.200 9.240 N Ulk1 n/a
4 TRCN0000361496 TCTCCCTCTGAGACTACTTAC pLKO_005 3957 3UTR 100% 10.800 7.560 N Ulk1 n/a
5 TRCN0000028768 CGCTTCTTTCTGGACAAACAA pLKO.1 3235 CDS 100% 5.625 3.938 N Ulk1 n/a
6 TRCN0000319764 CGCTTCTTTCTGGACAAACAA pLKO_005 3235 CDS 100% 5.625 3.938 N Ulk1 n/a
7 TRCN0000199173 CGTGGGCAAGTTCGAGTTCTC pLKO.1 387 CDS 100% 1.350 0.945 N ULK1 n/a
8 TRCN0000028783 CCGAGTCAAGATTGCTGACTT pLKO.1 834 CDS 100% 0.495 0.347 N Ulk1 n/a
9 TRCN0000350118 CCGAGTCAAGATTGCTGACTT pLKO_005 834 CDS 100% 0.495 0.347 N Ulk1 n/a
10 TRCN0000368734 CTTCCAGGAAATGGCTAATTC pLKO_005 597 CDS 100% 13.200 7.920 N Ulk1 n/a
11 TRCN0000028755 CCTGGTCATGGAGTATTGTAA pLKO.1 624 CDS 100% 5.625 3.375 N Ulk1 n/a
12 TRCN0000028801 GCCAAATGCAAGCTGTGCATT pLKO.1 3451 CDS 100% 0.495 0.297 N Ulk1 n/a
13 TRCN0000319703 GCCAAATGCAAGCTGTGCATT pLKO_005 3451 CDS 100% 0.495 0.297 N Ulk1 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4791 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009469.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.