Transcript: Mouse NM_009470.5

Mus musculus uromodulin (Umod), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Umod (22242)
Length:
2637
CDS:
200..2128

Additional Resources:

NCBI RefSeq record:
NM_009470.5
NBCI Gene record:
Umod (22242)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009470.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110903 CGAAGTGGGAACTTCATAGAT pLKO.1 1964 CDS 100% 0.563 0.788 N Umod n/a
2 TRCN0000110900 GCTTGCACGTACTCTTTCTTT pLKO.1 2235 3UTR 100% 5.625 4.500 N Umod n/a
3 TRCN0000110901 CCTGGCAAATGCGATCATCAT pLKO.1 1423 CDS 100% 4.950 3.465 N Umod n/a
4 TRCN0000110902 GTGTTCTGAATGCCACAACAA pLKO.1 292 CDS 100% 4.950 3.465 N Umod n/a
5 TRCN0000110904 TGTCCCGGTTTGTACTGCTAA pLKO.1 1689 CDS 100% 4.950 3.465 N Umod n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009470.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.