Transcript: Mouse NM_009489.2

Mus musculus vomeronasal 2, receptor 37 (Vmn2r37), mRNA.

Source:
NCBI, updated 2018-05-28
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r37 (22305)
Length:
3102
CDS:
116..2524

Additional Resources:

NCBI RefSeq record:
NM_009489.2
NBCI Gene record:
Vmn2r37 (22305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104991 CAATGGATGAAATCAACAGAA pLKO.1 357 CDS 100% 4.950 2.475 Y Vmn2r30 n/a
2 TRCN0000027925 CCCAGGAAGAAGATTGAGAAA pLKO.1 2017 CDS 100% 4.950 2.475 Y Vmn2r37 n/a
3 TRCN0000027877 GAAGAGACTATGTGTTCCTAT pLKO.1 512 CDS 100% 4.950 2.475 Y Vmn2r37 n/a
4 TRCN0000027869 GCACATTCTATGGATCACTTA pLKO.1 1059 CDS 100% 4.950 2.475 Y LOC381842 n/a
5 TRCN0000104914 CCACAAATATGCTTTGGCATT pLKO.1 328 CDS 100% 4.050 2.025 Y Vmn2r43 n/a
6 TRCN0000027909 CCCAACTACATTATTCCCATA pLKO.1 2057 CDS 100% 4.050 2.025 Y Vmn2r37 n/a
7 TRCN0000104874 GTTAGGAAAGTTCAGCCCATA pLKO.1 1558 CDS 100% 4.050 2.025 Y Vmn2r29 n/a
8 TRCN0000027874 CCAGAGAGAAATTCGACCCAA pLKO.1 2477 CDS 100% 2.640 1.320 Y Vmn2r37 n/a
9 TRCN0000027899 CTCCTTTCTAAGAAGGATTTA pLKO.1 1423 CDS 100% 1.320 0.660 Y Vmn2r37 n/a
10 TRCN0000027907 CCCAGGAAGAAGATTGAGATA pLKO.1 2017 CDS 100% 4.950 2.475 Y Vmn2r42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009489.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.