Transcript: Mouse NM_009491.3

Mus musculus vomeronasal 2, receptor 10 (Vmn2r10), mRNA.

Source:
NCBI, updated 2012-09-01
Taxon:
Mus musculus (mouse)
Gene:
Vmn2r10 (22307)
Length:
2544
CDS:
1..2544

Additional Resources:

NCBI RefSeq record:
NM_009491.3
NBCI Gene record:
Vmn2r10 (22307)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104887 CCTACTGACGACTCTTATAAT pLKO.1 166 CDS 100% 15.000 12.000 N Vmn2r10 n/a
2 TRCN0000104888 CGACTCTTATAATATCTCTGA pLKO.1 174 CDS 100% 2.640 1.848 N Vmn2r10 n/a
3 TRCN0000257361 CAGACCACATTTGGAGTATTT pLKO_005 1948 CDS 100% 13.200 6.600 Y Gm20783 n/a
4 TRCN0000104886 GCCATTTGACTGAACCCATTT pLKO.1 62 CDS 100% 10.800 5.400 Y Vmn2r10 n/a
5 TRCN0000194270 CCTCCAAAGAGCTGTGTCATT pLKO.1 1701 CDS 100% 4.950 2.475 Y Vmn2r16 n/a
6 TRCN0000104930 CCTCCCTTTATTGACAGAGAT pLKO.1 2146 CDS 100% 4.950 2.475 Y Vmn2r122 n/a
7 TRCN0000104882 CTTTGGACCATTTAATCCTAA pLKO.1 489 CDS 100% 4.950 2.475 Y Vmn2r-ps159 n/a
8 TRCN0000188910 GCTTTCAAGCTCACTACTCCA pLKO.1 2020 CDS 100% 2.640 1.320 Y LOC436147 n/a
9 TRCN0000104889 GCAGCAGTTGAGGGACCTACT pLKO.1 151 CDS 100% 1.350 0.675 Y Vmn2r10 n/a
10 TRCN0000028028 CCCTTTATTGACAGAGATATA pLKO.1 2149 CDS 100% 13.200 6.600 Y Vmn2r122 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.