Transcript: Mouse NM_009502.4

Mus musculus vinculin (Vcl), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Vcl (22330)
Length:
5229
CDS:
89..3289

Additional Resources:

NCBI RefSeq record:
NM_009502.4
NBCI Gene record:
Vcl (22330)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009502.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295603 GCGAGCGAATCCCAACTATAA pLKO_005 3042 CDS 100% 13.200 18.480 N Vcl n/a
2 TRCN0000091597 CGATACTACAACTCCTATCAA pLKO.1 1888 CDS 100% 5.625 7.875 N Vcl n/a
3 TRCN0000295657 ATCTCGCACCTGGTGATTATG pLKO_005 146 CDS 100% 13.200 9.240 N Vcl n/a
4 TRCN0000091594 GCTCGGAAGATTGCAGAATTA pLKO.1 1331 CDS 100% 13.200 9.240 N Vcl n/a
5 TRCN0000288325 GCTCGGAAGATTGCAGAATTA pLKO_005 1331 CDS 100% 13.200 9.240 N Vcl n/a
6 TRCN0000295656 CCACGATGAAGCTCGGAAATG pLKO_005 2803 CDS 100% 10.800 7.560 N Vcl n/a
7 TRCN0000091593 CCCTGTACTTTCAGTTACTAT pLKO.1 3466 3UTR 100% 5.625 3.938 N Vcl n/a
8 TRCN0000288326 CCCTGTACTTTCAGTTACTAT pLKO_005 3466 3UTR 100% 5.625 3.938 N Vcl n/a
9 TRCN0000091595 CCAGCCTTTATTAAGGTTGAA pLKO.1 314 CDS 100% 4.950 3.465 N Vcl n/a
10 TRCN0000091596 GCTGGTTCATAATGCCCAGAA pLKO.1 3154 CDS 100% 4.050 2.835 N Vcl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009502.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.