Transcript: Mouse NM_009526.3

Mus musculus wingless-type MMTV integration site family, member 6 (Wnt6), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Wnt6 (22420)
Length:
2068
CDS:
255..1349

Additional Resources:

NCBI RefSeq record:
NM_009526.3
NBCI Gene record:
Wnt6 (22420)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009526.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071803 CCGGAAGTAGTGGCAGAGCTT pLKO.1 426 CDS 100% 0.880 1.232 N Wnt6 n/a
2 TRCN0000071804 CGCAGCCGATTCACCCGACTT pLKO.1 1109 CDS 100% 0.000 0.000 N Wnt6 n/a
3 TRCN0000071806 CGCACCGAGTGTAAGTGCCAT pLKO.1 906 CDS 100% 0.880 0.704 N Wnt6 n/a
4 TRCN0000071805 GCCGTGGAGATATCCGTGCAT pLKO.1 832 CDS 100% 0.880 0.704 N Wnt6 n/a
5 TRCN0000071807 GAGACAGCTTTCGTGTTTGCA pLKO.1 561 CDS 100% 3.000 2.100 N Wnt6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009526.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.