Transcript: Mouse NM_009533.2

Mus musculus X-ray repair complementing defective repair in Chinese hamster cells 5 (Xrcc5), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Xrcc5 (22596)
Length:
2571
CDS:
127..2325

Additional Resources:

NCBI RefSeq record:
NM_009533.2
NBCI Gene record:
Xrcc5 (22596)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312882 AGGACCAACTGGACGTTATAA pLKO_005 557 CDS 100% 15.000 21.000 N Xrcc5 n/a
2 TRCN0000312877 TACGACAACTGTGCGTCTTTA pLKO_005 818 CDS 100% 13.200 18.480 N Xrcc5 n/a
3 TRCN0000312925 TTTGTCCAACGACAGGTATTT pLKO_005 247 CDS 100% 13.200 18.480 N Xrcc5 n/a
4 TRCN0000312920 GCTACGGAAGTGATATCATTC pLKO_005 1070 CDS 100% 10.800 15.120 N Xrcc5 n/a
5 TRCN0000071046 CGTCCGATATGCTTATGACAA pLKO.1 1302 CDS 100% 4.950 6.930 N Xrcc5 n/a
6 TRCN0000071047 GATGATTTACTGGACATGATA pLKO.1 2302 CDS 100% 5.625 3.938 N Xrcc5 n/a
7 TRCN0000071045 CGGAAGTGATATCATTCCTTT pLKO.1 1074 CDS 100% 4.950 3.465 N Xrcc5 n/a
8 TRCN0000071044 CCTGATTGTGTGCATGGATTT pLKO.1 456 CDS 100% 10.800 6.480 N Xrcc5 n/a
9 TRCN0000311823 CCTGATTGTGTGCATGGATTT pLKO_005 456 CDS 100% 10.800 6.480 N Xrcc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.