Transcript: Mouse NM_009569.4

Mus musculus zinc finger protein, multitype 1 (Zfpm1), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Zfpm1 (22761)
Length:
4001
CDS:
343..3330

Additional Resources:

NCBI RefSeq record:
NM_009569.4
NBCI Gene record:
Zfpm1 (22761)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085231 ACACTCTTTCTGCCACAATAT pLKO.1 1927 CDS 100% 13.200 18.480 N Zfpm1 n/a
2 TRCN0000085228 CGAGATCACCTTTAACAATAT pLKO.1 2127 CDS 100% 13.200 18.480 N Zfpm1 n/a
3 TRCN0000085229 CGAAACCTACACTGTGCACAA pLKO.1 2466 CDS 100% 4.050 3.240 N Zfpm1 n/a
4 TRCN0000085230 GCGAGATCACCTTTAACAATA pLKO.1 2126 CDS 100% 13.200 9.240 N Zfpm1 n/a
5 TRCN0000085232 GTGGCTTCATATCCACCACAA pLKO.1 1439 CDS 100% 4.050 2.835 N Zfpm1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009569.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.