Transcript: Mouse NM_009571.2

Mus musculus zinc finger protein 2, Y-linked (Zfy2), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Zfy2 (22768)
Length:
2816
CDS:
359..2692

Additional Resources:

NCBI RefSeq record:
NM_009571.2
NBCI Gene record:
Zfy2 (22768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125373 CTCGATTTAGATACAGCTGAA pLKO.1 644 CDS 100% 4.050 3.240 N Zfy2 n/a
2 TRCN0000125372 GATAGCCTAGTAGAAAGAGAA pLKO.1 806 CDS 100% 4.950 3.465 N Zfy2 n/a
3 TRCN0000125369 CCAGTATTACATCAACCTCAT pLKO.1 708 CDS 100% 4.050 2.835 N Zfy2 n/a
4 TRCN0000125370 GATACCAAAGAGGCTCAGCAA pLKO.1 2120 CDS 100% 2.640 1.584 N Zfy2 n/a
5 TRCN0000085322 CATCCTGAATACCTTGCTAAT pLKO.1 1631 CDS 100% 10.800 5.400 Y Zfy1 n/a
6 TRCN0000176461 CAAGCTTAATAAGAAGCGAAA pLKO.1 139 5UTR 100% 4.050 2.025 Y Cypt3 n/a
7 TRCN0000085319 GCAATATTTGTTGCTCCTGAT pLKO.1 1526 CDS 100% 4.050 2.025 Y Zfy1 n/a
8 TRCN0000085321 CCAAACAGTACCAGTCAGCAA pLKO.1 1509 CDS 100% 2.640 1.320 Y Zfy1 n/a
9 TRCN0000125371 CCATTTCTGCTTAGTCACCAT pLKO.1 2378 CDS 100% 2.640 1.320 Y Zfy2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009571.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.