Transcript: Mouse NM_009623.2

Mus musculus adenylate cyclase 8 (Adcy8), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Adcy8 (11514)
Length:
5064
CDS:
1192..4941

Additional Resources:

NCBI RefSeq record:
NM_009623.2
NBCI Gene record:
Adcy8 (11514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114958 CGCTATGAGAACGTCAGTATT pLKO.1 2410 CDS 100% 13.200 18.480 N Adcy8 n/a
2 TRCN0000114957 CGCAATATCTTACCCAGCCAT pLKO.1 4039 CDS 100% 2.640 3.696 N Adcy8 n/a
3 TRCN0000114960 CACGATGTTGACATGCGAATT pLKO.1 2689 CDS 100% 0.000 0.000 N Adcy8 n/a
4 TRCN0000114956 CCCAAGTAACTCGGATTTCTT pLKO.1 1590 CDS 100% 5.625 3.938 N Adcy8 n/a
5 TRCN0000114959 GCAGGTCTCTTTCTGAGTTAT pLKO.1 3817 CDS 100% 13.200 7.920 N Adcy8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.