Transcript: Mouse NM_009627.1

Mus musculus adrenomedullin (Adm), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Adm (11535)
Length:
1381
CDS:
176..730

Additional Resources:

NCBI RefSeq record:
NM_009627.1
NBCI Gene record:
Adm (11535)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340242 GTTCCGAAAGAAGTGGAATAA pLKO_005 262 CDS 100% 13.200 10.560 N Adm n/a
2 TRCN0000340244 GTCCAGCCAAAGGTAACTATA pLKO_005 1033 3UTR 100% 13.200 9.240 N Adm n/a
3 TRCN0000340245 TCCAGACTCTTTAGGATATAG pLKO_005 710 CDS 100% 13.200 9.240 N Adm n/a
4 TRCN0000340171 TCTACCAGCTAACAGACAAAG pLKO_005 540 CDS 100% 10.800 7.560 N Adm n/a
5 TRCN0000340170 ACCCAGACTCTTGATCCATTC pLKO_005 365 CDS 100% 6.000 4.200 N Adm n/a
6 TRCN0000098030 CCTCATTACTACTTGAACTTT pLKO.1 979 3UTR 100% 5.625 3.938 N Adm n/a
7 TRCN0000098032 GAAGCCCACATTCGTGTCAAA pLKO.1 434 CDS 100% 4.950 3.465 N Adm n/a
8 TRCN0000098033 AGAAACAAGATCAGCCCTCAA pLKO.1 581 CDS 100% 4.050 2.835 N Adm n/a
9 TRCN0000098031 GCAGTTCCGAAAGAAGTGGAA pLKO.1 259 CDS 100% 2.640 1.848 N Adm n/a
10 TRCN0000098034 GCCCACCAGATCTACCAGCTA pLKO.1 530 CDS 100% 0.880 0.616 N Adm n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009627.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.