Transcript: Mouse NM_009633.3

Mus musculus adrenergic receptor, alpha 2b (Adra2b), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Adra2b (11552)
Length:
3936
CDS:
280..1641

Additional Resources:

NCBI RefSeq record:
NM_009633.3
NBCI Gene record:
Adra2b (11552)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009633.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000026275 CCGCAGTCTATGTGACCATTT pLKO.1 1710 3UTR 100% 10.800 15.120 N Adra2b n/a
2 TRCN0000444172 TCTTCTGTCGGAGAGGCTAAT pLKO_005 1018 CDS 100% 10.800 15.120 N Adra2b n/a
3 TRCN0000026255 CGAATCTATGTAATTGCCAAA pLKO.1 874 CDS 100% 4.050 5.670 N Adra2b n/a
4 TRCN0000421870 GGCTCATTGCAGCCGTCATTT pLKO_005 704 CDS 100% 13.200 9.240 N Adra2b n/a
5 TRCN0000414359 TGGCCAAGGCTGATTAGAATA pLKO_005 1895 3UTR 100% 13.200 9.240 N Adra2b n/a
6 TRCN0000026311 CCTAGTGGCTACTCTTATCAT pLKO.1 471 CDS 100% 5.625 3.938 N Adra2b n/a
7 TRCN0000434796 AGCCGAGCATTGGAGTACAAC pLKO_005 637 CDS 100% 4.950 3.465 N Adra2b n/a
8 TRCN0000026316 CGAGAGAAGAGGTTCACCTTT pLKO.1 1381 CDS 100% 4.950 3.465 N Adra2b n/a
9 TRCN0000026244 GCTGGTAATTCTGGCTGTGTT pLKO.1 387 CDS 100% 4.950 3.465 N Adra2b n/a
10 TRCN0000436769 GGCTTCCAGCATCGGATCTTT pLKO_005 816 CDS 100% 5.625 3.375 N Adra2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009633.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.