Transcript: Mouse NM_009648.2

Mus musculus A kinase (PRKA) anchor protein 1 (Akap1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Akap1 (11640)
Length:
3721
CDS:
185..2758

Additional Resources:

NCBI RefSeq record:
NM_009648.2
NBCI Gene record:
Akap1 (11640)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088539 CCCAGTGGAAATCACGGTTAT pLKO.1 2317 CDS 100% 10.800 15.120 N Akap1 n/a
2 TRCN0000088542 CTACGTGGACTATGGTGGATA pLKO.1 2422 CDS 100% 4.950 6.930 N Akap1 n/a
3 TRCN0000332222 CTACGTGGACTATGGTGGATA pLKO_005 2422 CDS 100% 4.950 6.930 N Akap1 n/a
4 TRCN0000088538 CGGCAAATTAGGTCTGACTTT pLKO.1 2468 CDS 100% 4.950 3.960 N Akap1 n/a
5 TRCN0000354125 CGGCAAATTAGGTCTGACTTT pLKO_005 2468 CDS 100% 4.950 3.960 N Akap1 n/a
6 TRCN0000306298 GAGTGAGACATGGACTAATTG pLKO_005 3107 3UTR 100% 13.200 9.240 N Akap1 n/a
7 TRCN0000088540 CCGAGAGGTGATGACAACTTT pLKO.1 1487 CDS 100% 5.625 3.938 N Akap1 n/a
8 TRCN0000332224 CCGAGAGGTGATGACAACTTT pLKO_005 1487 CDS 100% 5.625 3.938 N Akap1 n/a
9 TRCN0000088541 GCTTCCTATGAGGAGACCAAT pLKO.1 2387 CDS 100% 4.950 3.465 N Akap1 n/a
10 TRCN0000332223 GCTTCCTATGAGGAGACCAAT pLKO_005 2387 CDS 100% 4.950 3.465 N Akap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009648.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.