Transcript: Mouse NM_009649.3

Mus musculus A kinase (PRKA) anchor protein 2 (Akap2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Akap2 (11641)
Length:
6651
CDS:
171..2558

Additional Resources:

NCBI RefSeq record:
NM_009649.3
NBCI Gene record:
Akap2 (11641)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361064 TGTGACAAAGGAGTCAATATA pLKO_005 2956 3UTR 100% 15.000 7.500 Y Akap2 n/a
2 TRCN0000368775 ACTTCAGCATGGACAACATAA pLKO_005 1714 CDS 100% 13.200 6.600 Y Akap2 n/a
3 TRCN0000361066 AGAGGAGGACAACGAATAAAC pLKO_005 2616 3UTR 100% 13.200 6.600 Y Akap2 n/a
4 TRCN0000361065 AGATCGGTCAATGTATCTTTG pLKO_005 1611 CDS 100% 10.800 5.400 Y Akap2 n/a
5 TRCN0000026876 CTGGTGCAGAATGCCATTCAA pLKO.1 1947 CDS 100% 5.625 2.813 Y Akap2 n/a
6 TRCN0000026916 CCATACAGTGAGCCTTCGAAA pLKO.1 1482 CDS 100% 4.950 2.475 Y Akap2 n/a
7 TRCN0000026872 GCCATACTGGTAAGCAGCTTA pLKO.1 420 CDS 100% 4.950 2.475 Y Akap2 n/a
8 TRCN0000026896 GCTGTTCTCTATCAAGCCTTA pLKO.1 1277 CDS 100% 4.050 2.025 Y Akap2 n/a
9 TRCN0000026909 CACGAGTCTTTAGACAACGAT pLKO.1 294 CDS 100% 3.000 1.500 Y Akap2 n/a
10 TRCN0000157791 CAGCGGACTTTGTCCATGATT pLKO.1 2376 CDS 100% 5.625 2.813 Y n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6173 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000178741 CACACACATACACACACACAA pLKO.1 6187 3UTR 100% 4.950 2.475 Y Cstad n/a
13 TRCN0000156405 CCCTTATCTAAACTGTGGGCT pLKO.1 1509 CDS 100% 0.660 0.330 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009649.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.