Transcript: Mouse NM_009650.2

Mus musculus A kinase (PRKA) anchor protein 3 (Akap3), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Akap3 (11642)
Length:
3173
CDS:
366..2960

Additional Resources:

NCBI RefSeq record:
NM_009650.2
NBCI Gene record:
Akap3 (11642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362688 GGGTTCCATAGACGAAGTTTC pLKO_005 722 CDS 100% 10.800 15.120 N Akap3 n/a
2 TRCN0000088523 CGGCACTAAGAAGTCTTTCTT pLKO.1 1067 CDS 100% 0.563 0.788 N Akap3 n/a
3 TRCN0000088524 GCCTTCCCAGATAACTTATAT pLKO.1 2523 CDS 100% 15.000 10.500 N Akap3 n/a
4 TRCN0000362753 TCCATGTGAAAGGCCTATTAC pLKO_005 2276 CDS 100% 13.200 9.240 N Akap3 n/a
5 TRCN0000368842 TTACTCAGCGAGACCATATTC pLKO_005 2172 CDS 100% 13.200 9.240 N Akap3 n/a
6 TRCN0000362689 AGGGACAAGTCGGAGAGTTAC pLKO_005 1563 CDS 100% 10.800 7.560 N Akap3 n/a
7 TRCN0000088526 CCAGCTAGACAACTGTATGAA pLKO.1 2375 CDS 100% 5.625 3.938 N Akap3 n/a
8 TRCN0000088525 CCAACCAGCTAGACAACTGTA pLKO.1 2371 CDS 100% 4.950 3.465 N Akap3 n/a
9 TRCN0000088527 GCCTCATTTCCCATGTTGGTA pLKO.1 697 CDS 100% 3.000 2.100 N Akap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009650.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.