Transcript: Mouse NM_009661.4

Mus musculus arachidonate 8-lipoxygenase (Alox8), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Alox8 (11688)
Length:
3273
CDS:
35..2068

Additional Resources:

NCBI RefSeq record:
NM_009661.4
NBCI Gene record:
Alox8 (11688)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009661.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416078 GGGATTCTCTGACCTGATAAA pLKO_005 1345 CDS 100% 13.200 18.480 N Alox8 n/a
2 TRCN0000076449 CCAGGCTACTATTACCGAGAT pLKO.1 1442 CDS 100% 4.050 5.670 N Alox8 n/a
3 TRCN0000076450 GCAGTTAATTCGTCAAGTTAT pLKO.1 1823 CDS 100% 13.200 9.240 N Alox8 n/a
4 TRCN0000434575 GGAAGCCCTGGTCCAGTATAT pLKO_005 1642 CDS 100% 13.200 9.240 N Alox8 n/a
5 TRCN0000076448 GCAGCTATCATACAGGCTTAT pLKO.1 2416 3UTR 100% 10.800 7.560 N Alox8 n/a
6 TRCN0000076452 CCAGCAGCAGAGTATGTGTTT pLKO.1 704 CDS 100% 4.950 3.465 N Alox8 n/a
7 TRCN0000076451 CCAGTTCCTAAATGGCATCAA pLKO.1 757 CDS 100% 4.950 3.465 N Alox8 n/a
8 TRCN0000201006 CCAGAGATCCTGAGTTCAATT pLKO.1 2776 3UTR 100% 13.200 6.600 Y Ripply3 n/a
9 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 2784 3UTR 100% 2.640 1.320 Y BC028528 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2171 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009661.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.