Transcript: Mouse NM_009710.4

Mus musculus ADP-ribosyltransferase 1 (Art1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Art1 (11870)
Length:
1417
CDS:
93..1070

Additional Resources:

NCBI RefSeq record:
NM_009710.4
NBCI Gene record:
Art1 (11870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009710.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110341 CGCAGTACATACAACTGTGAA pLKO.1 891 CDS 100% 4.950 6.930 N Art1 n/a
2 TRCN0000110344 GCGTCCTTTGATGACCAGTAT pLKO.1 222 CDS 100% 4.950 6.930 N Art1 n/a
3 TRCN0000110342 CGAAACTTTCCAGGTGATCAA pLKO.1 815 CDS 100% 4.950 3.960 N Art1 n/a
4 TRCN0000110343 GCCAACAAAGTATACGCGGAT pLKO.1 303 CDS 100% 2.160 1.512 N Art1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009710.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.