Transcript: Mouse NM_009712.3

Mus musculus arylsulfatase B (Arsb), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Arsb (11881)
Length:
3989
CDS:
100..1704

Additional Resources:

NCBI RefSeq record:
NM_009712.3
NBCI Gene record:
Arsb (11881)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009712.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101506 GCGCCGATTGAGTCTTTGAAT pLKO.1 646 CDS 100% 5.625 7.875 N Arsb n/a
2 TRCN0000101509 CCGAGGATTCGATACCTACTT pLKO.1 579 CDS 100% 4.950 6.930 N Arsb n/a
3 TRCN0000101508 CAAGATAAGCACAGACGTATT pLKO.1 877 CDS 100% 10.800 7.560 N Arsb n/a
4 TRCN0000101507 CCAAGATAAGCACAGACGTAT pLKO.1 876 CDS 100% 4.950 3.465 N Arsb n/a
5 TRCN0000190876 CTATTTGACTGTCAGCCCTTT pLKO.1 2875 3UTR 100% 4.050 2.835 N Arsb n/a
6 TRCN0000192551 GAGGATTATTCACAGTTGCAT pLKO.1 2616 3UTR 100% 3.000 1.800 N Arsb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009712.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.