Transcript: Mouse NM_009745.2

Mus musculus B cell CLL/lymphoma 7B (Bcl7b), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bcl7b (12054)
Length:
1678
CDS:
136..744

Additional Resources:

NCBI RefSeq record:
NM_009745.2
NBCI Gene record:
Bcl7b (12054)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277158 GTCGGATGTCTATCAACTCAA pLKO_005 426 CDS 100% 4.950 6.930 N Bcl7b n/a
2 TRCN0000193052 CCCTGCCTCTATTTATTGCAT pLKO.1 772 3UTR 100% 3.000 2.400 N Bcl7b n/a
3 TRCN0000277218 CCAGAGCATCAGGGTTCATTT pLKO_005 984 3UTR 100% 13.200 9.240 N Bcl7b n/a
4 TRCN0000328923 GATACCTCCCTGAGGATATTC pLKO_005 253 CDS 100% 13.200 9.240 N Bcl7b n/a
5 TRCN0000328922 ATGGGTGCCTGTGACAGATAG pLKO_005 276 CDS 100% 10.800 7.560 N Bcl7b n/a
6 TRCN0000192451 CCTGAGGATATTCAAATGGGT pLKO.1 261 CDS 100% 0.750 0.525 N Bcl7b n/a
7 TRCN0000192670 GCATCTGAAGTTGCAGATGAA pLKO.1 586 CDS 100% 0.495 0.347 N Bcl7b n/a
8 TRCN0000201602 CCTGCATCTGAAGTTGCAGAT pLKO.1 583 CDS 100% 0.405 0.284 N Bcl7b n/a
9 TRCN0000277224 CCTGCATCTGAAGTTGCAGAT pLKO_005 583 CDS 100% 0.405 0.284 N Bcl7b n/a
10 TRCN0000033578 AGTGCGGAAATGGGAGAAGAA pLKO.1 216 CDS 100% 4.950 2.970 N BCL7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009745.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.