Transcript: Mouse NM_009841.4

Mus musculus CD14 antigen (Cd14), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cd14 (12475)
Length:
1681
CDS:
325..1425

Additional Resources:

NCBI RefSeq record:
NM_009841.4
NBCI Gene record:
Cd14 (12475)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009841.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306484 CAACGAATCCTCTGCTTTAAA pLKO_005 1464 3UTR 100% 15.000 21.000 N Cd14 n/a
2 TRCN0000306483 ATCCCACTCGGAGAAGTTTAA pLKO_005 1311 CDS 100% 13.200 18.480 N Cd14 n/a
3 TRCN0000306538 TATCAAGTCTCTGTCCTTAAA pLKO_005 567 CDS 100% 13.200 18.480 N Cd14 n/a
4 TRCN0000067601 CGGATTCCTAGTCGGATTCTA pLKO.1 610 CDS 100% 5.625 7.875 N Cd14 n/a
5 TRCN0000354230 CGGATTCCTAGTCGGATTCTA pLKO_005 610 CDS 100% 5.625 7.875 N Cd14 n/a
6 TRCN0000311548 GTCAGCTAAACTCGCTCAATC pLKO_005 1133 CDS 100% 10.800 8.640 N Cd14 n/a
7 TRCN0000067599 CGAGGAAAGTTGTTCCTGCAA pLKO.1 402 CDS 100% 0.264 0.211 N Cd14 n/a
8 TRCN0000067602 GACTAGACCTTAGTCACAATT pLKO.1 1070 CDS 100% 1.320 0.924 N Cd14 n/a
9 TRCN0000067598 CCTGTCTGACAATCCTGAATT pLKO.1 912 CDS 100% 0.000 0.000 N Cd14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009841.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.