Transcript: Mouse NM_009865.3

Mus musculus cadherin 10 (Cdh10), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cdh10 (320873)
Length:
3425
CDS:
487..2853

Additional Resources:

NCBI RefSeq record:
NM_009865.3
NBCI Gene record:
Cdh10 (320873)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251668 ATGAGAACCGAAGACTATATA pLKO_005 1499 CDS 100% 15.000 21.000 N Cdh10 n/a
2 TRCN0000251671 GAAGTGGATTACCGCATTATT pLKO_005 1393 CDS 100% 15.000 21.000 N Cdh10 n/a
3 TRCN0000251669 GCACACGTTTCCCACTTATTT pLKO_005 2957 3UTR 100% 15.000 21.000 N Cdh10 n/a
4 TRCN0000251670 TTATAGCTGCTGAGATCAATA pLKO_005 1862 CDS 100% 13.200 10.560 N Cdh10 n/a
5 TRCN0000251667 TCTACGTGCACAAGCTATTAA pLKO_005 864 CDS 100% 15.000 10.500 N Cdh10 n/a
6 TRCN0000054288 GCACAATCATTGGTACTGTAA pLKO.1 1685 CDS 100% 4.950 3.465 N CDH10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009865.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.