Transcript: Mouse NM_009872.3

Mus musculus cyclin-dependent kinase 5, regulatory subunit 2 (p39) (Cdk5r2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cdk5r2 (12570)
Length:
2704
CDS:
70..1179

Additional Resources:

NCBI RefSeq record:
NM_009872.3
NBCI Gene record:
Cdk5r2 (12570)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009872.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361091 ACTTCTTCACGCAAGTCTTTC pLKO_005 1016 CDS 100% 10.800 15.120 N Cdk5r2 n/a
2 TRCN0000361029 GGCAAGACCAGGCCTTCATTA pLKO_005 743 CDS 100% 13.200 10.560 N Cdk5r2 n/a
3 TRCN0000024669 CCACTTCTTCACGCAAGTCTT pLKO.1 1014 CDS 100% 4.950 3.960 N Cdk5r2 n/a
4 TRCN0000024673 CGCCAACCTGGTGTTCGTGTA pLKO.1 768 CDS 100% 1.350 1.080 N Cdk5r2 n/a
5 TRCN0000378366 ATCAAGCCACCGTCGCTATTA pLKO_005 1246 3UTR 100% 13.200 9.240 N Cdk5r2 n/a
6 TRCN0000024671 GCCTCGGCCAAGAAGAAGAAA pLKO.1 283 CDS 100% 5.625 3.938 N Cdk5r2 n/a
7 TRCN0000361028 CTACCTCGCCTACTCCTACAT pLKO_005 867 CDS 100% 4.950 3.465 N Cdk5r2 n/a
8 TRCN0000024670 GCAAGTCTTTCAAGACCTCAA pLKO.1 1026 CDS 100% 4.050 2.835 N Cdk5r2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009872.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.