Transcript: Mouse NM_009924.4

Mus musculus cannabinoid receptor 2 (macrophage) (Cnr2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cnr2 (12802)
Length:
4084
CDS:
478..1521

Additional Resources:

NCBI RefSeq record:
NM_009924.4
NBCI Gene record:
Cnr2 (12802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009924.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221788 CCTCTCAGCATTGATTTCTTA pLKO.1 954 CDS 100% 5.625 3.938 N Cnr2 n/a
2 TRCN0000221785 CCGCTACCTATGTCTGTGTTA pLKO.1 867 CDS 100% 4.950 3.465 N Cnr2 n/a
3 TRCN0000221787 CGCCTGCAACTTTGTCATCTT pLKO.1 738 CDS 100% 4.950 3.465 N Cnr2 n/a
4 TRCN0000221786 CCTTGTTAACTCTATGGTCAA pLKO.1 1341 CDS 100% 4.050 2.835 N Cnr2 n/a
5 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 3941 3UTR 100% 2.640 1.320 Y BC028528 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009924.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.