Transcript: Mouse NM_009930.2

Mus musculus collagen, type III, alpha 1 (Col3a1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Col3a1 (12825)
Length:
5564
CDS:
211..4605

Additional Resources:

NCBI RefSeq record:
NM_009930.2
NBCI Gene record:
Col3a1 (12825)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091483 CCAGTGCAAGTGACCAACTAA pLKO.1 4676 3UTR 100% 5.625 7.875 N Col3a1 n/a
2 TRCN0000091484 CGTGGCTCTAATGGCATCAAA pLKO.1 3505 CDS 100% 5.625 7.875 N Col3a1 n/a
3 TRCN0000091485 CCAACGTAGATGAATTGGGAT pLKO.1 287 CDS 100% 2.640 3.696 N Col3a1 n/a
4 TRCN0000371816 ATGTCTCAATGGTGCTATAAT pLKO_005 4831 3UTR 100% 15.000 12.000 N COL3A1 n/a
5 TRCN0000091487 CTCAAGTCTGTTAATGGACAA pLKO.1 3916 CDS 100% 4.050 2.835 N Col3a1 n/a
6 TRCN0000091486 CGAACTCAAGAGTGGAGAATA pLKO.1 4014 CDS 100% 13.200 7.920 N Col3a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009930.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.