Transcript: Mouse NM_009931.2

Mus musculus collagen, type IV, alpha 1 (Col4a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Col4a1 (12826)
Length:
6636
CDS:
228..5237

Additional Resources:

NCBI RefSeq record:
NM_009931.2
NBCI Gene record:
Col4a1 (12826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306536 ATCGGACCCACTGGTGATAAA pLKO_005 3102 CDS 100% 13.200 18.480 N Col4a1 n/a
2 TRCN0000090437 GCAATTACTACGCAAATGCTT pLKO.1 5092 CDS 100% 3.000 4.200 N Col4a1 n/a
3 TRCN0000327101 GCAATTACTACGCAAATGCTT pLKO_005 5092 CDS 100% 3.000 4.200 N Col4a1 n/a
4 TRCN0000311578 TCCTGGACAGGCACAAGTTAA pLKO_005 953 CDS 100% 13.200 9.240 N Col4a1 n/a
5 TRCN0000090433 CCTAGAATTATATCCTGTGTA pLKO.1 5331 3UTR 100% 4.950 3.465 N Col4a1 n/a
6 TRCN0000327103 CCTAGAATTATATCCTGTGTA pLKO_005 5331 3UTR 100% 4.950 3.465 N Col4a1 n/a
7 TRCN0000090436 CCATGGATACTCTCTGCTCTA pLKO.1 4631 CDS 100% 4.050 2.835 N Col4a1 n/a
8 TRCN0000327102 CCATGGATACTCTCTGCTCTA pLKO_005 4631 CDS 100% 4.050 2.835 N Col4a1 n/a
9 TRCN0000090435 GCAGAGATGGTCTTGAAGGAT pLKO.1 1738 CDS 100% 3.000 2.100 N Col4a1 n/a
10 TRCN0000090434 CCAAAGGATCAGTTGGAGGAA pLKO.1 3253 CDS 100% 2.640 1.848 N Col4a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009931.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.