Transcript: Mouse NM_009933.4

Mus musculus collagen, type VI, alpha 1 (Col6a1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Col6a1 (12833)
Length:
3990
CDS:
132..3209

Additional Resources:

NCBI RefSeq record:
NM_009933.4
NBCI Gene record:
Col6a1 (12833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091535 CCAGGATTTGATGGCATTCAA pLKO.1 1173 CDS 100% 5.625 7.875 N Col6a1 n/a
2 TRCN0000091536 CCACCTATTCCGTGTACCAAA pLKO.1 3125 CDS 100% 4.950 6.930 N Col6a1 n/a
3 TRCN0000091537 GACACCATTGTGGACATGATT pLKO.1 825 CDS 100% 5.625 3.938 N Col6a1 n/a
4 TRCN0000091533 GCACACTCTTTGCTTTGTGTA pLKO.1 3348 3UTR 100% 4.950 3.465 N Col6a1 n/a
5 TRCN0000091534 CCCACACAGAACAACCGAATT pLKO.1 2277 CDS 100% 0.000 0.000 N Col6a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009933.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.