Transcript: Mouse NM_009993.3

Mus musculus cytochrome P450, family 1, subfamily a, polypeptide 2 (Cyp1a2), mRNA.

Source:
NCBI, updated 2017-06-21
Taxon:
Mus musculus (mouse)
Gene:
Cyp1a2 (13077)
Length:
1892
CDS:
60..1601

Additional Resources:

NCBI RefSeq record:
NM_009993.3
NBCI Gene record:
Cyp1a2 (13077)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_009993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000173611 GCGCTGTATCTACATAAACCA pLKO.1 1265 CDS 100% 3.000 4.200 N Cyp1a2 n/a
2 TRCN0000176256 CAAGAACAGTATCCAAGACAT pLKO.1 884 CDS 100% 4.950 3.465 N Cyp1a2 n/a
3 TRCN0000193801 CAATGATAACTTCGTGCTGTT pLKO.1 824 CDS 100% 4.050 2.835 N Cyp1a2 n/a
4 TRCN0000173500 GTCAGCATCCTCTTGCTATTT pLKO.1 518 CDS 100% 13.200 7.920 N Cyp1a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_009993.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.